Prev. | 

RIKEN DNA Bank Human Resource - MICOS13

Gene ID NCBI Gene 125988 |  KEGG hsa:125988
Gene Symbol MICOS13
Protein Name mitochondrial contact site and cristae organizing system subunit 13
Synonyms C19orf70|MIC13|P117|QIL1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005878 IRAK014L14 pCMV-SPORT6 BC009557 NM_205767 Full
HGY042739 IRAK106O03 pBluescript BC042386 NM_205767 Full/var
HGX046102 IRAK115E06 pCMV-SPORT6 BC052640 NM_205767 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR337725 RBb44F05 pGCAP1 NM_205767.1  
GGCGCGTGGATCCGAGCGACCATGGTGGCCCGGGTGTGGTCGCTGATGAGGTTCCTCATC
HKR388836 RBd72B12 pGCAP10 NM_205767.1  
GGCGCGTGGATCCGAGCGACCATGGTGGCCCGGGTGTGGTCGCTGATGAGGTTCCTCATC
HKR394171 RBd85H03 pGCAP10 NM_205767.1  
GGACAGGAAGCGGCGGGCGAGCCGAGTGTCCTTGCGCGTGGATCCGAGCGACCATGGTGG
HKR432554 RBdS081G10 pGCAP10 NM_205767.1  
GCTTGCGCGTGGATCCGAGCGACCATGGTGGCCCGGGTGTGGTCGCTGATGAGGTTCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl