Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05511

HP ID(1) HP05511
Gene ID(2) 55148
Gene Symbol finder UBR7
Protein Name ubiquitin protein ligase E3 component n-recognin 7 (putative)
RefSeq NM_175748.3
Length of RefSeq (bp) 3709
Chromosome 14q32.12
Reference DDBJ accession
UniGene Hs.648806

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi10H12 pGCAP10 GGCCGGGGCCGAGCCGCTGTTCGGCTGACAGTTGAGGATGGCCGGAGCCGAGGGCGCCGC
RBb16H05 pKA1U5 TTGGCCGCTTTTCCCGCCTCCGCCGGGGCCGAGCCGCTGTTCGGCTGACAGTTGAGGATG
RBb59H06 pGCAP1 GGCTGTTCGGCTGACAGTTGAGGATGGCCGGAGCCGAGGGCGCCGCTGGGCGGCAGTCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl