Prev. |  KEGG KO K11979 > 

RIKEN DNA Bank Human Resource - UBR7

Gene ID NCBI Gene 55148 |  KEGG hsa:55148
Gene Symbol UBR7
Protein Name ubiquitin protein ligase E3 component n-recognin 7
Synonyms C14orf130
Ortholog resource in our bank

  UBR7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006063 IRAK015C15 pCMV-SPORT6 BC015046 NM_175748
HGX044303 IRAK110M15 pCMV-SPORT6 BC051819 NM_018108 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE040732 W01A101N20 pENTR-TOPO IRAK015C15 BC015046 NM_175748  
HGE040734 W01A101N22 pENTR-TOPO IRAK015C15 BC015046 NM_175748  
HGE040764 W01A101P04 pENTR-TOPO IRAK015C15 BC015046 NM_175748  
HGE040772 W01A101P12 pENTR-TOPO IRAK015C15 BC015046 NM_175748  
HGE040776 W01A101P16 pENTR-TOPO IRAK015C15 BC015046 NM_175748  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR164180 ARi10H12 pGCAP10 NM_175748.3  
GGCCGGGGCCGAGCCGCTGTTCGGCTGACAGTTGAGGATGGCCGGAGCCGAGGGCGCCGC
HKR326573 RBb16H05 pKA1U5 NM_175748.3  
TTGGCCGCTTTTCCCGCCTCCGCCGGGGCCGAGCCGCTGTTCGGCTGACAGTTGAGGATG
HKR343774 RBb59H06 pGCAP1 NM_175748.3  
GGCTGTTCGGCTGACAGTTGAGGATGGCCGGAGCCGAGGGCGCCGCTGGGCGGCAGTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl