Prev. |  Human A to Z list >  U >  UBR7 > 

RBb59H06 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR343774
Clone Name RBb59H06
Clone info. Plasmid clone of human UBR7 cDNA with SV40 promoter
Vector Click for information pGCAP1
5'-terminal sequence(1) GGCTGTTCGGCTGACAGTTGAGGATGGCCGGAGCCGAGGGCGCCGCTGGGCGGCAGTCGG
Sequence, submitted(2) n.a.
 
Sequence, refered NM_175748.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) UBR7 (NCBI Gene 55148)  other clone of UBR7 in our bank
Synonyms C14orf130
Protein Name ubiquitin protein ligase E3 component n-recognin 7 (putative)
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR343774 RBb59H06 DNA solution

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2018.12.05

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_181121.pl