Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05446

HP ID(1) HP05446
Gene ID(2) 5870
Gene Symbol finder RAB6A
Protein Name RAB6A, member RAS oncogene family
RefSeq NM_002869.4
Length of RefSeq (bp) 3419
Chromosome 11q13.3
Reference DDBJ accession
UniGene Hs.503222

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe44E11 pKA1U5 GGCCGCGCCAGAGGCTCGCGCACTCAGCAGGTTTGGGNTGCGGCGGCGGCNGCAGCTGTG
ARi41F06 pGCAP10 GGCCCCGCGCCGCTCCAGAGGCTCGCGCACTCAGCAGGTTGGGCTGCGGCGGCGGCGGCA
ARiS109M15 pGCAP10 GGCGCCCNNGCTCGCCCCGCGCCGCTCCAGAGGCTCGCGCACTCAGCAGGTTGGGCTGCG
ARiS198M12 pGCAP10 GACTCAGCAGGTTGGGCTGCGGCGGCGGCGGCAGCTGTGGAAGCTCAGGCGCTGCGCGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl