Prev. |  KEGG KO K07893 > 

RIKEN DNA Bank Human Resource - RAB6A

Gene ID NCBI Gene 5870 |  KEGG hsa:5870
Gene Symbol RAB6A
Protein Name RAB6A, member RAS oncogene family
Synonyms RAB6
Featured content Rab Family - human
Ortholog resource in our bank

  RAB6A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018674 IRAK046L10 pBluescriptR BC034996 NM_198896 Partial
HGX035784 IRAK089H16 pCMV-SPORT6 BC044241 NM_198896
HGY067465 IRAK168L01 pBluescriptR BC068486 NM_002869 Full
HGY082808 IRAL007A08 pOTB7 BC003617 NM_002869 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR057707 ARe44E11 pKA1U5 NM_002869.4  
GGCCGCGCCAGAGGCTCGCGCACTCAGCAGGTTTGGGNTGCGGCGGCGGCNGCAGCTGTG
HKR176526 ARi41F06 pGCAP10 NM_002869.4  
GGCCCCGCGCCGCTCCAGAGGCTCGCGCACTCAGCAGGTTGGGCTGCGGCGGCGGCGGCA
HKR243903 ARiS109M15 pGCAP10 NM_002869.4  
GGCGCCCNNGCTCGCCCCGCGCCGCTCCAGAGGCTCGCGCACTCAGCAGGTTGGGCTGCG
HKR279500 ARiS198M12 pGCAP10 NM_002869.4  
GACTCAGCAGGTTGGGCTGCGGCGGCGGCGGCAGCTGTGGAAGCTCAGGCGCTGCGCGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl