Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05440

HP ID(1) HP05440
Gene ID(2) 10130
Gene Symbol finder PDIA6
Protein Name protein disulfide isomerase family A, member 6
RefSeq NM_005742.2
Length of RefSeq (bp) 2344
Chromosome 2p25.1
Reference DDBJ accession
UniGene Hs.212102

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe43H05 pKA1U5 ATCCTGGGACTGCACGTAGCCCGGCGCTCGGCATGGCTCTCCTGGTGCTCGGTCTGGTGA
ARe52D05 pKA1U5 GGGACTGGCCTGTGGCGGGACGTGGGCGCGGGCCGCGCGGCGNTGCGGCACNCTGCAAGG
ARe71C11 pKA1U5 GGGGACGTGGGCGCGGGGGCGCGGCGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCG
ARe78E05 pKA1U5 GGGACGTGGGCGCGGGGGCGCGGCGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCGG
ARe87A06 pKA1U5 TTGGTGGGCGGGACGTGGGCGCGGGGGCGCGGCGTGCGGCACGCTGCAGGGCTGAAGCGG
ARf04B09 pKA1U5 GACTGCACGTAGCCCGGCGCTCGGCATGGCTCTCCTGGTGCTCGGTCTGGTGAGCTGTAC
ARf06F05 pKA1U5 GGAAGCGGCGGCGGCGGTGGGGACTGCACGTAGCCCGGCGCTCGGCATGGCTCTCCTGGT
ARi17C05 pGCAP10 GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
ARi59C09 pGCAP10 GGGGACGTGGGCGCGGGGGCGCGGCGTGCGGCACGCTGCANGGCTGANCGGCGGCGGCGG
ARiS049A10 pGCAP10 GGGACTGGCCTGGGGCGGGACGTGGGCGCGGGGGCGCGGCGTGCGGCACGCTGCAGGGCT
ARiS049F19 pGCAP10 GGGCGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCGGTGGGGACTGCACGTAGCCCG
ARiS049J12 pGCAP10 GGAAGCGGCGGCGGCGGTGGGGACTGCACGTAGCCCGGCGCTCGGCATGGCTCTCCTGGT
ARiS109B18 pGCAP10 GGGACCACCGGACTGGCCTGGGGCGGGACGTGGGCGCGGGGGCGCGGCGTGCGGCACGCT
ARiS109D13 pGCAP10 GGCGGGGGCGCGGCGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCGGTGGGGACTGC
ARiS150P24 pGCAP10 GGGGGACTGCACGTAGCCCGGCGCTCGGCATGGCTCTCCTGGTGCTCGGTCTGGTGAGCT
ARiS194B22 pGCAP10 CGGCCGGCCGATGGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCGGTGGGGACTG
RBb39F11 pGCAP1 GGCTGAAGCGGCGGCGGCGGTGGGGACTGCACGTAGCCCGGCGCTCGGCATGGCTCTCCT
RBb59A02 pGCAP1 TGAGGGCTGAAGCGGCGGCGGCGGTGGGGACTGCACGTAGCCCGGCGCTCGGCATGGCTC
RBd29G05 pGCAP10 GGGGCGCGGCGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCGGTGGGGACTGCACGT
RBd54D01 pGCAP10 GGCCGCCCCTCGGACCACCGGACTGGCCTGGGGCGGGACGTGGNNNCGGGGGCGCGGCGT
RBd63G05 pGCAP10 GGGGGGCGCGGCGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCGGTGGGGACTGCAC
RBd70G10 pGCAP10 GGGACCACCGGACTGGCCTGGGGCGGGACGTGGGCGCGGGGGCGCGGCGTGCGGCACGCT
RBd94E10 pGCAP10 GGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCGGTGGGGACTGCACGTAGCCCGGCG
RBdS015D08 pGCAP10 GGGGACGTGGGCGCGGGGGCGCGGCGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCG
RBdS015H05 pGCAP10 GGGGACGTGGGCGCGGGGGCGCGGCGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCG
RBdS070C02 pGCAP10 GGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCGGTGGGGACTGCACGTAGCCCGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl