Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS070C02

Clone ID RBdS070C02
HP ID HP05440
Gene ID 10130
Gene Symbol PDIA6
Protein Name protein disulfide isomerase family A, member 6
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005742.2
Length of RefSeq (bp) 2344
Chromosome 2p25.1
Reference DDBJ accession
UniGene Hs.212102
5'-terminal sequence GGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCGGTGGGGACTGCACGTAGCCCGGCG
2011.08.28