Prev. |  KEGG KO K09584 > 

RIKEN DNA Bank Human Resource - PDIA6

Gene ID NCBI Gene 10130 |  KEGG hsa:10130
Gene Symbol PDIA6
Protein Name protein disulfide isomerase family A member 6
Synonyms ERP5|P5|TXNDC7
Ortholog resources KEGG ortholog (KEGG orthology K09584) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001773 IRAK004H05 pCMV-SPORT6 BC001312 NM_005742 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR057373 ARe43H05 pKA1U5 NM_005742.2  
ATCCTGGGACTGCACGTAGCCCGGCGCTCGGCATGGCTCTCCTGGTGCTCGGTCTGGTGA
HKR060877 ARe52D05 pKA1U5 NM_005742.2  
GGGACTGGCCTGTGGCGGGACGTGGGCGCGGGCCGCGCGGCGNTGCGGCACNCTGCAAGG
HKR068459 ARe71C11 pKA1U5 NM_005742.2  
GGGGACGTGGGCGCGGGGGCGCGGCGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCG
HKR071301 ARe78E05 pKA1U5 NM_005742.2  
GGGACGTGGGCGCGGGGGCGCGGCGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCGG
HKR074806 ARe87A06 pKA1U5 NM_005742.2  
TTGGTGGGCGGGACGTGGGCGCGGGGGCGCGGCGTGCGGCACGCTGCAGGGCTGAAGCGG
HKR081633 ARf04B09 pKA1U5 NM_005742.2  
GACTGCACGTAGCCCGGCGCTCGGCATGGCTCTCCTGGTGCTCGGTCTGGTGAGCTGTAC
HKR082525 ARf06F05 pKA1U5 NM_005742.2  
GGAAGCGGCGGCGGCGGTGGGGACTGCACGTAGCCCGGCGCTCGGCATGGCTCTCCTGGT
HKR166853 ARi17C05 pGCAP10 NM_005742.2  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR183657 ARi59C09 pGCAP10 NM_005742.2  
GGGGACGTGGGCGCGGGGGCGCGGCGTGCGGCACGCTGCANGGCTGANCGGCGGCGGCGG
HKR219610 ARiS049A10 pGCAP10 NM_005742.2  
GGGACTGGCCTGGGGCGGGACGTGGGCGCGGGGGCGCGGCGTGCGGCACGCTGCAGGGCT
HKR219739 ARiS049F19 pGCAP10 NM_005742.2  
GGGCGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCGGTGGGGACTGCACGTAGCCCG
HKR219828 ARiS049J12 pGCAP10 NM_005742.2  
GGAAGCGGCGGCGGCGGTGGGGACTGCACGTAGCCCGGCGCTCGGCATGGCTCTCCTGGT
HKR243642 ARiS109B18 pGCAP10 NM_005742.2  
GGGACCACCGGACTGGCCTGGGGCGGGACGTGGGCGCGGGGGCGCGGCGTGCGGCACGCT
HKR243685 ARiS109D13 pGCAP10 NM_005742.2  
GGCGGGGGCGCGGCGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCGGTGGGGACTGC
HKR260384 ARiS150P24 pGCAP10 NM_005742.2  
GGGGGACTGCACGTAGCCCGGCGCTCGGCATGGCTCTCCTGGTGCTCGGTCTGGTGAGCT
HKR277646 ARiS194B22 pGCAP10 NM_005742.2  
CGGCCGGCCGATGGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCGGTGGGGACTG
HKR335731 RBb39F11 pGCAP1 NM_005742.2  
GGCTGAAGCGGCGGCGGCGGTGGGGACTGCACGTAGCCCGGCGCTCGGCATGGCTCTCCT
HKR343602 RBb59A02 pGCAP1 NM_005742.2  
TGAGGGCTGAAGCGGCGGCGGCGGTGGGGACTGCACGTAGCCCGGCGCTCGGCATGGCTC
HKR371749 RBd29G05 pGCAP10 NM_005742.2  
GGGGCGCGGCGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCGGTGGGGACTGCACGT
HKR381673 RBd54D01 pGCAP10 NM_005742.2  
GGCCGCCCCTCGGACCACCGGACTGGCCTGGGGCGGGACGTGGNNNCGGGGGCGCGGCGT
HKR385349 RBd63G05 pGCAP10 NM_005742.2  
GGGGGGCGCGGCGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCGGTGGGGACTGCAC
HKR388154 RBd70G10 pGCAP10 NM_005742.2  
GGGACCACCGGACTGGCCTGGGGCGGGACGTGGGCGCGGGGGCGCGGCGTGCGGCACGCT
HKR397706 RBd94E10 pGCAP10 NM_005742.2  
GGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCGGTGGGGACTGCACGTAGCCCGGCG
HKR406080 RBdS015D08 pGCAP10 NM_005742.2  
GGGGACGTGGGCGCGGGGGCGCGGCGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCG
HKR406173 RBdS015H05 pGCAP10 NM_005742.2  
GGGGACGTGGGCGCGGGGGCGCGGCGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCG
HKR428050 RBdS070C02 pGCAP10 NM_005742.2  
GGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCGGTGGGGACTGCACGTAGCCCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl