Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05429

HP ID(1) HP05429
Gene ID(2) 55213
Gene Symbol finder RCBTB1
Protein Name regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
RefSeq NM_018191.3
Length of RefSeq (bp) 4042
Chromosome 13q14
Reference DDBJ accession
UniGene Hs.508021

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe41H12 pKA1U5 GGCTGCCGGTGGGCACCGCCGCTCGCTCGCACTTCTGCGCCCATTGGAGCTTCGGAGATC
ARiS194F04 pGCAP10 CNGCCGNNNNATGGCTCCTCCTCTTCGCTGCCGGNGGGCACCGCCGCTCGCTCGCACTTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl