Prev. |  KEGG KO K11494 > 

RIKEN DNA Bank Human Resource - RCBTB1

Gene ID NCBI Gene 55213 |  KEGG hsa:55213
Gene Symbol RCBTB1
Protein Name RCC1 and BTB domain containing protein 1
Synonyms CLLD7|CLLL7|GLP|RDEOA
Ortholog resources KEGG ortholog (KEGG orthology K11494) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY019180 IRAK047P20 pBluescriptR BC038104 NM_018191 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE025481 W01A063L17 pENTR-TOPO flj0041d10 AK096654 NM_018191  
HGE025485 W01A063L21 pENTR-TOPO flj0041d10 AK096654 NM_018191  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056580 ARe41H12 pKA1U5 NM_018191.3  
GGCTGCCGGTGGGCACCGCCGCTCGCTCGCACTTCTGCGCCCATTGGAGCTTCGGAGATC
HKR277724 ARiS194F04 pGCAP10 NM_018191.3  
CNGCCGNNNNATGGCTCCTCCTCTTCGCTGCCGGNGGGCACCGCCGCTCGCTCGCACTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl