Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05410

HP ID(1) HP05410
Gene ID(2) 5998
Gene Symbol finder RGS3
Protein Name regulator of G-protein signalling 3
RefSeq NM_134427.1
Length of RefSeq (bp) 1582
Chromosome 9q32
Reference DDBJ accession
UniGene Hs.494875

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe40D09 pKA1U5 GAGTGCCAGGGGGTGCCGTTGTGAGGGATGGACNCCTCTCCCCCGGAGCAGCACTTTGGG
ARe85A12 pKA1U5 GAGTCATCAGGCCAGGATTCCAGAGAGCGTGTGTGGCTGCAGCCTGCACCGTTGCTGCCC
ARf07H07 pKA1U5 GGGAGACTCCGGNTTACTGGGGAGCAACACAGCCGCCTCGGGTTGCAGACGCTCCTGTCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl