Prev. |  KEGG KO K07524 > 

RIKEN DNA Bank Human Resource - RGS3

Gene ID NCBI Gene 5998 |  KEGG hsa:5998
Gene Symbol RGS3
Protein Name regulator of G protein signaling 3
Synonyms C2PA|RGP3
Ortholog resources KEGG ortholog (KEGG orthology K07524) in the DNA Bank
Featured content Axon guidance - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056081 ARe40D09 pKA1U5 NM_134427.1  
GAGTGCCAGGGGGTGCCGTTGTGAGGGATGGACNCCTCTCCCCCGGAGCAGCACTTTGGG
HKR074012 ARe85A12 pKA1U5 NM_134427.1  
GAGTCATCAGGCCAGGATTCCAGAGAGCGTGTGTGGCTGCAGCCTGCACCGTTGCTGCCC
HKR082975 ARf07H07 pKA1U5 NM_134427.1  
GGGAGACTCCGGNTTACTGGGGAGCAACACAGCCGCCTCGGGTTGCAGACGCTCCTGTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl