Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05402

HP ID(1) HP05402
Gene ID(2) 84440
Gene Symbol finder RAB11FIP4
Protein Name RAB11 family interacting protein 4 (class II)
RefSeq NM_032932.3
Length of RefSeq (bp) 8665
Chromosome 17q11.2
Reference DDBJ accession
UniGene Hs.406788

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb15F11 pKA1U5 GCTCCGGAGCGGCTGGGGCTGCGGCGCCGCTGCTGACACGGATCGGCCGCGGCCGCCACC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl