Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RAB11FIP4

Gene ID (NCBI) 84440
Gene Symbol RAB11FIP4
Protein Name RAB11 family interacting protein 4 (class II)
Synonyms RAB11-FIP4
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX039429 IRAK098J13 pCMV-SPORT6 BC047674 NM_032932 Partial/var
HGY085780 IRAL014H12 pOTB7 BC004515 NM_032932 Partial/var
HGY086089 IRAL015D17 pOTB7 BC006240 NM_032932 Partial/var
HGY093372 IRAL033H04 pOTB7 BC023618 NM_032932

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR326131 RBb15F11 pKA1U5 NM_032932.3  
GCTCCGGAGCGGCTGGGGCTGCGGCGCCGCTGCTGACACGGATCGGCCGCGGCCGCCACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl