Prev. |  KEGG KO K12485 > 

RIKEN DNA Bank Human Resource - RAB11FIP4

Gene ID NCBI Gene 84440 |  KEGG hsa:84440
Gene Symbol RAB11FIP4
Protein Name RAB11 family interacting protein 4
Synonyms FIP4-Rab11|RAB11-FIP4
Ortholog resources KEGG ortholog (KEGG orthology K12485) in the DNA Bank
Featured content Endocytosis (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX039429 IRAK098J13 pCMV-SPORT6 BC047674 NM_032932 Partial/var
HGY085780 IRAL014H12 pOTB7 BC004515 NM_032932 Partial/var
HGY086089 IRAL015D17 pOTB7 BC006240 NM_032932 Partial/var
HGY093372 IRAL033H04 pOTB7 BC023618 NM_032932

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR326131 RBb15F11 pKA1U5 NM_032932.3  
GCTCCGGAGCGGCTGGGGCTGCGGCGCCGCTGCTGACACGGATCGGCCGCGGCCGCCACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl