Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05399

HP ID(1) HP05399
Gene ID(2) 51552
Gene Symbol finder RAB14
Protein Name RAB14, member RAS oncogene family
RefSeq NM_016322.3
Length of RefSeq (bp) 4379
Chromosome 9q32-q34.11
Reference DDBJ accession
UniGene Hs.371563

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi42B11 pGCAP10 GAGCCCGAGGAAGATACTGAGGGAGCACAGGAGCAGTCACCGCTGCCACTGCTACTGCCG
ARi61H09 pGCAP10 GGAGCGCCGCCATCTTGGACCAGCCCGAGGAAGATACTGAGGGAGCACAGGAGCAGTCAC
RBb21H11 pKA1U5 GGTGCAGGGAGCGCCGCCATCTTGGACCAGCCCCATTTAAGATACTGAGGGAGCACAGGA
RBd84H04 pGCAP10 GAGCACAGGAGCAGTCACCGCTGCCACTGCTACTGCCGCTACTGCTGCCGGCGCGTCTGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl