Prev. |  KEGG KO K07881 > 

RIKEN DNA Bank Human Resource - RAB14

Gene ID NCBI Gene 51552 |  KEGG hsa:51552
Gene Symbol RAB14
Protein Name RAB14, member RAS oncogene family
Synonyms FBP|RAB-14
Ortholog resources KEGG ortholog (KEGG orthology K07881) in the DNA Bank
Featured content Rab Family - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087243 IRAL018B19 pOTB7 BC006081 NM_016322 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR176835 ARi42B11 pGCAP10 NM_016322.3  
GAGCCCGAGGAAGATACTGAGGGAGCACAGGAGCAGTCACCGCTGCCACTGCTACTGCCG
HKR184577 ARi61H09 pGCAP10 NM_016322.3  
GGAGCGCCGCCATCTTGGACCAGCCCGAGGAAGATACTGAGGGAGCACAGGAGCAGTCAC
HKR328579 RBb21H11 pKA1U5 NM_016322.3  
GGTGCAGGGAGCGCCGCCATCTTGGACCAGCCCCATTTAAGATACTGAGGGAGCACAGGA
HKR393772 RBd84H04 pGCAP10 NM_016322.3  
GAGCACAGGAGCAGTCACCGCTGCCACTGCTACTGCCGCTACTGCTGCCGGCGCGTCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl