Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05360

HP ID(1) HP05360
Gene ID(2) 55559
Gene Symbol finder UCHL5IP
Protein Name UCHL5 interacting protein
RefSeq NM_017518.5
Length of RefSeq (bp) 1363
Chromosome Xq28
Reference DDBJ accession
UniGene Hs.170835

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb15F04 pKA1U5 GGCGCGAAACATGGCGGGGCAGGACGCTGGCTGCGNNCGTGGCGGCGACGACTACTCAGA
RBd87D12 pGCAP10 GAGGGTTTGGGCGGGGCGCGGCTCGGAGCGCGAAACATGGCGGGGCAGGACGCTGGCTGC
RBdS132J23 pGCAP10 CGGCCGGCCGATGGGCTCGGAGCGCGAAACATGGCGGGGCAGGACGCTGGCTGCGGCCGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl