Prev. |  KEGG KO K16590 > 

RIKEN DNA Bank Human Resource - HAUS7

Gene ID NCBI Gene 55559 |  KEGG hsa:55559
Gene Symbol HAUS7
Protein Name HAUS augmin like complex subunit 7
Synonyms UCHL5IP|UIP1
Ortholog resource in our bank

  HAUS7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007692 IRAK019D20 pCMV-SPORT6 BC008141 NM_017518 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE006250 W01A015K10 pENTR-TOPO IRAK019D20 BC008141 NM_017518  
HGE006254 W01A015K14 pENTR-TOPO IRAK019D20 BC008141 NM_017518  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR326124 RBb15F04 pKA1U5 NM_017518.5  
GGCGCGAAACATGGCGGGGCAGGACGCTGGCTGCGNNCGTGGCGGCGACGACTACTCAGA
HKR394884 RBd87D12 pGCAP10 NM_017518.5  
GAGGGTTTGGGCGGGGCGCGGCTCGGAGCGCGAAACATGGCGGGGCAGGACGCTGGCTGC
HKR453039 RBdS132J23 pGCAP10 NM_017518.5  
CGGCCGGCCGATGGGCTCGGAGCGCGAAACATGGCGGGGCAGGACGCTGGCTGCGGCCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl