Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS132J23

Clone ID RBdS132J23
HP ID HP05360
Gene ID 55559
Gene Symbol UCHL5IP
Protein Name UCHL5 interacting protein
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_017518.5
Length of RefSeq (bp) 1363
Chromosome Xq28
Reference DDBJ accession
UniGene Hs.170835
5'-terminal sequence CGGCCGGCCGATGGGCTCGGAGCGCGAAACATGGCGGGGCAGGACGCTGGCTGCGGCCGT
2011.08.28