Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05349

HP ID(1) HP05349
Gene ID(2) 57521
Gene Symbol finder RPTOR
Protein Name regulatory associated protein of MTOR, complex 1
RefSeq NM_020761.2
Length of RefSeq (bp) 6856
Chromosome 17q25.3
Reference DDBJ accession
UniGene Hs.133044

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb14F04 pKA1U5 GAGTTTCACTGNTATCTCCAAACCAGAGGGCAAAGCCTCCCATGACCCAATTAAGCCCAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl