Prev. |  KEGG KO K07204 > 

RIKEN DNA Bank Human Resource - RPTOR

Gene ID NCBI Gene 57521 |  KEGG hsa:57521
Gene Symbol RPTOR
Protein Name regulatory associated protein of MTOR complex 1
Synonyms KOG1|Mip1
Ortholog resource in our bank

  RPTOR

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX020915 IRAK052E19 pCMV-SPORT6 BC025180 NM_020761 Partial
HGX066458 IRAK166C10 pCMV-SPORT6 BC073898 NM_020761 Partial
HGY093721 IRAL034F01 pOTB7 BC014502 NM_020761 Partial/var
HGY097583 IRAL043P23 pOTB7 BC033258 NM_020761 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR325724 RBb14F04 pKA1U5 NM_020761.2  
GAGTTTCACTGNTATCTCCAAACCAGAGGGCAAAGCCTCCCATGACCCAATTAAGCCCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl