Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05331

HP ID(1) HP05331
Gene ID(2) 5986
Gene Symbol finder RFNG
Protein Name RFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
RefSeq NM_002917.1
Length of RefSeq (bp) 1828
Chromosome 17q25
Reference DDBJ accession
UniGene Hs.569700

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS096F22 pGCAP10 GNNANNGCTCCGGCCANGTTCTCCNCTCCCAGCNCCNGGGGTCCCGGCGGCCGCATGANC
RBb13C06 pKA1U5 AAAAGGGGCCGCCTCCCACCCACAGATTCCGGCCAGGCTTATCCGCGTCGNAGCGCCACG
RBb37E02 pGCAP1
RBd39G06 pGCAP10 TGGGCCGCCCACCCACGGCTCCGGCCAGGTTCTCCGCTCGCAGCGCCGGGGGTCCCGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl