Prev. |  KEGG KO K05948 > 

RIKEN DNA Bank Human Resource - RFNG

Gene ID NCBI Gene 5986 |  KEGG hsa:5986
Gene Symbol RFNG
Protein Name RFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Synonyms -
Featured content Notch signaling pathway (human)
Ortholog resource in our bank

  RFNG

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX039218 IRAK098A18 pCMV-SPORT6 BC050399 NM_002917 Partial/var
HGY093645 IRAL034B21 pOTB7 BC014495 NM_002917 Partial/var
HGY101887 IRAL054L23 pOTB7 BC069034 NM_002917 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR238542 ARiS096F22 pGCAP10 NM_002917.1  
GNNANNGCTCCGGCCANGTTCTCCNCTCCCAGCNCCNGGGGTCCCGGCGGCCGCATGANC
HKR325254 RBb13C06 pKA1U5 NM_002917.1  
AAAAGGGGCCGCCTCCCACCCACAGATTCCGGCCAGGCTTATCCGCGTCGNAGCGCCACG
HKR334898 RBb37E02 pGCAP1 NM_002917.1  
HKR375750 RBd39G06 pGCAP10 NM_002917.1  
TGGGCCGCCCACCCACGGCTCCGGCCAGGTTCTCCGCTCGCAGCGCCGGGGGTCCCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl