Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05281

HP ID(1) HP05281
Gene ID(2) 146760
Gene Symbol finder RTN4RL1
Protein Name reticulon 4 receptor-like 1
RefSeq NM_178568.2
Length of RefSeq (bp) 3183
Chromosome 17p13.3
Reference DDBJ accession
UniGene Hs.22917

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb09C01 pKA1U5 TGAAAACGCGCGCCGGGCGCTTTCCCCGGAGCTCGGCGGTGCGTGCGAGCGCCCTTTTGC
RBdS022C11 pGCAP10 GGCGCGCCGGGCGCTNTCCCCGGAGCTCGGCGGTGCGTGCGAGCGCCCTTTTGCTGCAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl