Prev. |  KEGG KO K16660 > 

RIKEN DNA Bank Human Resource - RTN4RL1

Gene ID NCBI Gene 146760 |  KEGG hsa:146760
Gene Symbol RTN4RL1
Protein Name reticulon 4 receptor like 1
Synonyms NGRH2|NgR3
Ortholog resource in our bank

  RTN4RL1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX016997 IRAK042I05 pCMV-SPORT6 BC023311 NM_178568

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR323649 RBb09C01 pKA1U5 NM_178568.2  
TGAAAACGCGCGCCGGGCGCTTTCCCCGGAGCTCGGCGGTGCGTGCGAGCGCCCTTTTGC
HKR408859 RBdS022C11 pGCAP10 NM_178568.2  
GGCGCGCCGGGCGCTNTCCCCGGAGCTCGGCGGTGCGTGCGAGCGCCCTTTTGCTGCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl