Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05270

HP ID(1) HP05270
Gene ID(2) 11021
Gene Symbol finder RAB35
Protein Name RAB35, member RAS oncogene family
RefSeq NM_006861.4
Length of RefSeq (bp) 2931
Chromosome 12q24.31
Reference DDBJ accession
UniGene Hs.524788

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS023L02 pGCAP10 GAGTTCCGGCTGTTTGTTCGGGAAGTGGATCCGCCGCTGCCGGAGCAGCCCGAAGGGAGC
RBb08F10 pKA1U5 ATCCTGTGGATCATCGGCGACAGCGGTGTGGGCAAGAGCAGTTTACTGTTGCGTTTTGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl