Prev. |  KEGG KO K07876 > 

RIKEN DNA Bank Human Resource - RAB35

Gene ID NCBI Gene 11021 |  KEGG hsa:11021
Gene Symbol RAB35
Protein Name RAB35, member RAS oncogene family
Synonyms H-ray|RAB1C|RAY
Featured content Endocytosis (human)
Featured content Rab Family - human
Ortholog resource in our bank

  RAB35

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006041 IRAK015B17 pCMV-SPORT6 BC015931 NM_006861 Full
HGX011115 IRAK027N03 pCMV-SPORT6 BC017753 NM_006861

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE121224 M01C103A24 pDONR221 06_12-B12 BC015931 NM_006861  
HGE121272 M01C103C24 pDONR221 06_12-B12 BC015931 NM_006861  
HGE121320 M01C103E24 pDONR221 06_12-B12 BC015931 NM_006861  
HGE121368 M01C103G24 pDONR221 06_12-B12 BC015931 NM_006861  
HGE121416 M01C103I24 pDONR221 06_12-B12 BC015931 NM_006861  
HGE121464 M01C103K24 pDONR221 06_12-B12 BC015931 NM_006861  
HGE121512 M01C103M24 pDONR221 06_12-B12 BC015931 NM_006861  
HGE121560 M01C103O24 pDONR221 06_12-B12 BC015931 NM_006861  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR209466 ARiS023L02 pGCAP10 NM_006861.4  
GAGTTCCGGCTGTTTGTTCGGGAAGTGGATCCGCCGCTGCCGGAGCAGCCCGAAGGGAGC
HKR323330 RBb08F10 pKA1U5 NM_006861.4  
ATCCTGTGGATCATCGGCGACAGCGGTGTGGGCAAGAGCAGTTTACTGTTGCGTTTTGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl