Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05250

HP ID(1) HP05250
Gene ID(2) 4218
Gene Symbol finder RAB8A
Protein Name RAB8A, member RAS oncogene family
RefSeq NM_005370.4
Length of RefSeq (bp) 2194
Chromosome 19p13.1
Reference DDBJ accession
UniGene Hs.642874

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi31C06 pGCAP10 CGGCCGGCCGATTGGAGAGTGTAATATGGCGAAGACCTACGATTACCTGTTCAAGCTGCT
ARi41A04 pGCAP10 GGAGAGTGTAATATGGCGAAGACCTACGATTACCTGTTCAAGCTGCTGCTGATCGGGGAC
ARi71D11 pGCAP10 GAGAGTGTAATATGGCGAAGACCTACGATTACCTGTTCAAGCTGCTGCTGATCGGGGACT
RBb07B09 pKA1U5 GTGTAATATGGCGAAGACCTACGATTACCTGTTCAAGCTGCTGCTGATCGGGGACTCGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl