Prev. |  KEGG KO K07901 > 

RIKEN DNA Bank Human Resource - RAB8A

Gene ID NCBI Gene 4218 |  KEGG hsa:4218
Gene Symbol RAB8A
Protein Name RAB8A, member RAS oncogene family
Synonyms MEL|RAB8
Featured content Endocytosis (human)
Featured content Rab Family - human
Ortholog resource in our bank

  RAB8A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083294 IRAL008D22 pOTB7 BC002977 NM_005370 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE021491 W01A053M03 pENTR-TOPO flj0063h19 AK025165 NM_005370  
HGE021493 W01A053M05 pENTR-TOPO flj0063h19 AK025165 NM_005370  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR172454 ARi31C06 pGCAP10 NM_005370.4  
CGGCCGGCCGATTGGAGAGTGTAATATGGCGAAGACCTACGATTACCTGTTCAAGCTGCT
HKR176404 ARi41A04 pGCAP10 NM_005370.4  
GGAGAGTGTAATATGGCGAAGACCTACGATTACCTGTTCAAGCTGCTGCTGATCGGGGAC
HKR188483 ARi71D11 pGCAP10 NM_005370.4  
GAGAGTGTAATATGGCGAAGACCTACGATTACCTGTTCAAGCTGCTGCTGATCGGGGACT
HKR322833 RBb07B09 pKA1U5 NM_005370.4  
GTGTAATATGGCGAAGACCTACGATTACCTGTTCAAGCTGCTGCTGATCGGGGACTCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl