Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05236

HP ID(1) HP05236
Gene ID(2) 81892
Gene Symbol finder C14orf156
Protein Name chromosome 14 open reading frame 156
RefSeq NM_031210.4
Length of RefSeq (bp) 436
Chromosome 14q24.3
Reference DDBJ accession
UniGene Hs.655105

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe91D11 pKA1U5 GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
ARi10A05 pGCAP10 GGCAACACATCCGTAGAAGGCAGCGCGGCCGCCGAGANCCGCAGCGCCGCTCGCCCGCCG
ARi58D09 pGCAP10 GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
ARiS049G06 pGCAP10 GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
RBb06C09 pKA1U5 GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
RBb29H01 pGCAP1 GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
RBb60B04 pGCAP1 GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
RBb63F02 pGCAP1 GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
RBd11H06 pGCAP10 GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
RBd31G10 pGCAP10 GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
RBd80E04 pGCAP10 GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
RBd93E11 pGCAP10 GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
RBd99C10 pGCAP10 GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
RBdS081J22 pGCAP10 GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
RBdS083B19 pGCAP10 GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
RBdS104L03 pGCAP10 CGGCCGGCCGATGAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl