Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081J22

Clone ID RBdS081J22
HP ID HP05236
Gene ID 81892
Gene Symbol C14orf156
Protein Name chromosome 14 open reading frame 156
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_031210.4
Length of RefSeq (bp) 436
Chromosome 14q24.3
Reference DDBJ accession
UniGene Hs.655105
5'-terminal sequence GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
2011.08.28