Prev. | 

RIKEN DNA Bank Human Resource - SLIRP

Gene ID NCBI Gene 81892 |  KEGG hsa:81892
Gene Symbol SLIRP
Protein Name SRA stem-loop interacting RNA binding protein
Synonyms C14orf156|DC50|PD04872
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY094098 IRAL035E02 pDNR-LIB BC017895 NM_031210 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR076483 ARe91D11 pKA1U5 NM_031210.4  
GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
HKR164005 ARi10A05 pGCAP10 NM_031210.4  
GGCAACACATCCGTAGAAGGCAGCGCGGCCGCCGAGANCCGCAGCGCCGCTCGCCCGCCG
HKR183281 ARi58D09 pGCAP10 NM_031210.4  
GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
HKR219750 ARiS049G06 pGCAP10 NM_031210.4  
GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
HKR322457 RBb06C09 pKA1U5 NM_031210.4  
GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
HKR331769 RBb29H01 pGCAP1 NM_031210.4  
GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
HKR344028 RBb60B04 pGCAP1 NM_031210.4  
GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
HKR345322 RBb63F02 pGCAP1 NM_031210.4  
GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
HKR364574 RBd11H06 pGCAP10 NM_031210.4  
GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
HKR372554 RBd31G10 pGCAP10 NM_031210.4  
GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
HKR392100 RBd80E04 pGCAP10 NM_031210.4  
GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
HKR397307 RBd93E11 pGCAP10 NM_031210.4  
GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
HKR399658 RBd99C10 pGCAP10 NM_031210.4  
GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
HKR432638 RBdS081J22 pGCAP10 NM_031210.4  
GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
HKR433243 RBdS083B19 pGCAP10 NM_031210.4  
GAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCGTAGAAGTATCAA
HKR441867 RBdS104L03 pGCAP10 NM_031210.4  
CGGCCGGCCGATGAGTCTGAAGATGGCGGCCTCAGCAGCGCGAGGTGCTGCGGCGCTGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl