Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05219

HP ID(1) HP05219
Gene ID(2) 100309464
Gene Symbol finder OTX2OS1
Protein Name Otx2 opposite strand transcript 1
RefSeq NR_029385.1
Length of RefSeq (bp) 2440
Chromosome 14q22.3
Reference DDBJ accession
UniGene Hs.637962

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb04F06 pKA1U5 AB593038 GAGAGAGGAGAAAGAGAACTAGAGACAGAGAGAGGCAGACAAGGAAGGGGGGGGGGGTGA
RBb62B02 pGCAP1 AB593038 GAGAGAGGAGAAAGAGAACTAGAGACAGAGAGAGGCAGACAAGGAAGGGGGGGGGGGTGA
RBd85E01 pGCAP10 AB593039 GGCCCAGACTCTGCAGCAGTTGGTAGCAGGCAAGCTTTCTCCTGGGTGTCGCCTTGAAAA
RBd93G10 pGCAP10 AB593040 GATCAAAGAGAATTTCCCTTTAGCTTAGCAATGTGCTGAAGCTCTTAAAAGATTGGATCT
RBdS132I21 pGCAP10 GGCGCACGAGGCAGCAAGCTCTCGGCAGCCGGGCTCCGGCTCGGGCTCGGCCTGGGGCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl