RBd85E01 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR394097 Clone Name RBd85E01 Clone info. Plasmid clone of human OTX2OS1 cDNA with SV40 promoter Vector Click for information pGCAP10 5'-terminal sequence(1) GGCCCAGACTCTGCAGCAGTTGGTAGCAGGCAAGCTTTCTCCTGGGTGTCGCCTTGAAAA Sequence, submitted(2) AB593039 [link]   Sequence, refered NR_029385.1 (NCBI RefSeq mRNA) Gene Symbol and ID(3) OTX2-AS1 (NCBI Gene 100309464)  other clone of OTX2-AS1 in our bank Synonyms OTX2OS1 Protein Name OTX2 antisense RNA 1 (head to head) KEGG hsa:100309464

Links   NCBI Gene   NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

2018.05.24