Prev. | 

RIKEN DNA Bank Human Resource - OTX2-AS1

Gene ID NCBI Gene 100309464 |  KEGG hsa:100309464
Gene Symbol OTX2-AS1
Protein Name OTX2 antisense RNA 1 (head to head)
Synonyms OTX2OS1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX035165 IRAK087P05 pCMV-SPORT6 BC041486

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR321726 RBb04F06 pKA1U5 NR_029385.1  
GAGAGAGGAGAAAGAGAACTAGAGACAGAGAGAGGCAGACAAGGAAGGGGGGGGGGGTGA
HKR344826 RBb62B02 pGCAP1 NR_029385.1  
GAGAGAGGAGAAAGAGAACTAGAGACAGAGAGAGGCAGACAAGGAAGGGGGGGGGGGTGA
HKR394097 RBd85E01 pGCAP10 NR_029385.1  
GGCCCAGACTCTGCAGCAGTTGGTAGCAGGCAAGCTTTCTCCTGGGTGTCGCCTTGAAAA
HKR397354 RBd93G10 pGCAP10 NR_029385.1  
GATCAAAGAGAATTTCCCTTTAGCTTAGCAATGTGCTGAAGCTCTTAAAAGATTGGATCT
HKR453013 RBdS132I21 pGCAP10 NR_029385.1  
GGCGCACGAGGCAGCAAGCTCTCGGCAGCCGGGCTCCGGCTCGGGCTCGGCCTGGGGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.10.13

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl