Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05210

HP ID(1) HP05210
Gene ID(2) 729515
Gene Symbol finder C6orf35
Protein Name chromosome 6 open reading frame 35
RefSeq NM_018452.4
Length of RefSeq (bp) 5046
Chromosome 6q25.3
Reference DDBJ accession
UniGene Hs.157212

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe64D02 pKA1U5 GGAGGCGACCTAAACATGGTAGACAGCGGGCGCTGCAACTGGGCAGCCGGCCTCTGGGCT
RBb04A11 pKA1U5 GGTTGGGGACGGACGCACTAGAGGCGACCTAAACATGGAGACAGCGGGCGCTGCAACTGG
RBd04G05 pGCAP10 GGGGGACGGACGCACTAGAGGCGACCTAAACATGGAGACAGCGGGCGCTGCAACTGGGCA
RBd97G12 pGCAP10 GAGAGGCGACCTAAACATGGAGACAGCGGGCGCTGCAACTGGGCAGCCGGCCTCTGGGCT
RBdS040M08 pGCAP10 GAGAGGCGACCTAAACATGGAGACAGCGGGCGCTGCAACTGGGCAGCCGGCCTCTGGGCT
RBdS156M12 pGCAP10 GGACCTAAACATGGAGACAGCGGGCGCTGCAACTGGGCAGCCGGCCTCTGGGCTGGAGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl