Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156M12

Clone ID RBdS156M12
HP ID HP05210
Gene ID 729515
Gene Symbol C6orf35
Protein Name chromosome 6 open reading frame 35
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_018452.4
Length of RefSeq (bp) 5046
Chromosome 6q25.3
Reference DDBJ accession
UniGene Hs.157212
5'-terminal sequence GGACCTAAACATGGAGACAGCGGGCGCTGCAACTGGGCAGCCGGCCTCTGGGCTGGAGGC
2011.08.28