Prev. | 

RIKEN DNA Bank Human Resource - TMEM242

Gene ID NCBI Gene 729515 |  KEGG hsa:729515
Gene Symbol TMEM242
Protein Name transmembrane protein 242
Synonyms BM033|C6orf35
Links

  KEGG gene

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04805 SEREX clone NGO-Pr-184 5' (ID 2540); NGO-Pr-184 3' (ID 2541) #1 SEREX clone NGO-Pr-184 5' (ID 2540); NGO-Pr-184 3' (ID 2541) #1

RDB_org_190226.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR065674 ARe64D02 pKA1U5 NM_018452.4  
GGAGGCGACCTAAACATGGTAGACAGCGGGCGCTGCAACTGGGCAGCCGGCCTCTGGGCT
HKR321611 RBb04A11 pKA1U5 NM_018452.4  
GGTTGGGGACGGACGCACTAGAGGCGACCTAAACATGGAGACAGCGGGCGCTGCAACTGG
HKR361749 RBd04G05 pGCAP10 NM_018452.4  
GGGGGACGGACGCACTAGAGGCGACCTAAACATGGAGACAGCGGGCGCTGCAACTGGGCA
HKR398956 RBd97G12 pGCAP10 NM_018452.4  
GAGAGGCGACCTAAACATGGAGACAGCGGGCGCTGCAACTGGGCAGCCGGCCTCTGGGCT
HKR416296 RBdS040M08 pGCAP10 NM_018452.4  
GAGAGGCGACCTAAACATGGAGACAGCGGGCGCTGCAACTGGGCAGCCGGCCTCTGGGCT
HKR462700 RBdS156M12 pGCAP10 NM_018452.4  
GGACCTAAACATGGAGACAGCGGGCGCTGCAACTGGGCAGCCGGCCTCTGGGCTGGAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl