Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05170

HP ID(1) HP05170
Gene ID(2) 10966
Gene Symbol finder RAB40B
Protein Name RAB40B, member RAS oncogene family
RefSeq NM_006822.1
Length of RefSeq (bp) 1673
Chromosome 17q25.3
Reference DDBJ accession
UniGene Hs.484068

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb01D07 pKA1U5 GGCTGGGCGGCGGGGCGGGGCCGGAGGCGANCAATTNANTCGGGGCCCGCGCGGCGCCTC
RBb12F07 pKA1U5 GTCGGGGCCGGGCCGCCGCCTCTGCGCTCAGCCCCGNAGGCCGGGCATGGGTGGGGGCGC
RBb60H03 pGCAP1 GGGAGGCGAGCAAGGACTCGGGGCCCGCGCGGCGCCTCTCGGGGCCGGGCCGCCGCCTCT
RBd91C02 pGCAP10 GGGGGGCCCGCGCGGCGCCTCTCGGGGCCGGGCCGCCGCCTCTGCGCTCAGCCCCGCAGG
RBdS083K12 pGCAP10 GGGAGGCGAGCAAGGACTCGGGGCCCGCGCGGCGCCTCTCGGGGCCGGGCCGCCGCCTCT
RBdS156M23 pGCAP10 GGGGGCCGGGCCGCCGCCTCTGCGCTCAGCCCCGCAGGCCGGGCATGGGTGGGGGCGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl