DNA Bank Top |  KEGG KO K07928 > 

RIKEN DNA Bank Human Resource - RAB40B

Gene ID NCBI Gene 10966 |  KEGG hsa:10966
Gene Symbol RAB40B
Protein Name RAB40B, member RAS oncogene family
Synonyms RAR|SEC4L
Featured content Rab Family - human

Link

Ortholog resource in our bank

  RAB40B


External database

human RAB40B

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB20886 pEGFP-C1-hRab40B Expression vector of human Rab40B tagged with EGFP at N-terminus    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013002 IRAK032I10 pBluescriptR BC018039 NM_006822 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2025Apr02.csv
GNP_full_IRAL_2025Apr02.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR320479 RBb01D07 pKA1U5 NM_006822.1  
GGCTGGGCGGCGGGGCGGGGCCGGAGGCGANCAATTNANTCGGGGCCCGCGCGGCGCCTC
HKR324927 RBb12F07 pKA1U5 NM_006822.1  
GTCGGGGCCGGGCCGCCGCCTCTGCGCTCAGCCCCGNAGGCCGGGCATGGGTGGGGGCGC
HKR344171 RBb60H03 pGCAP1 NM_006822.1  
GGGAGGCGAGCAAGGACTCGGGGCCCGCGCGGCGCCTCTCGGGGCCGGGCCGCCGCCTCT
HKR396450 RBd91C02 pGCAP10 NM_006822.1  
GGGGGGCCCGCGCGGCGCCTCTCGGGGCCGGGCCGCCGCCTCTGCGCTCAGCCCCGCAGG
HKR433452 RBdS083K12 pGCAP10 NM_006822.1  
GGGAGGCGAGCAAGGACTCGGGGCCCGCGCGGCGCCTCTCGGGGCCGGGCCGCCGCCTCT
HKR462711 RBdS156M23 pGCAP10 NM_006822.1  
GGGGGCCGGGCCGCCGCCTCTGCGCTCAGCCCCGCAGGCCGGGCATGGGTGGGGGCGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_20250404.csv
NRCDhumcloneList_RB_20250404.csv


2025.05.09

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl