Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05146

HP ID(1) HP05146
Gene ID(2) 23433
Gene Symbol finder RHOQ
Protein Name ras homolog gene family, member Q
RefSeq NM_012249.3
Length of RefSeq (bp) 4542
Chromosome 2p21
Reference DDBJ accession
UniGene Hs.709193

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe38B11 pKA1U5 GGCCGCCCTCCCCAAAGTTGCCGTCTCCCCCGGGGCCGGCCGGTCTTATGATCCGGCGGA
ARi21C09 pGCAP10 GCTTATGATCCGNGCGGATCCTCCTGGGGAGGCCGGGCCGGGGNGTGGGTGCGGGCGCCG
ARi25D11 pGCAP10 GGGGGCGGGGATCCGGGCGGCGACCGCGGCGGCGGCAGCGNCNNTNNNNNCGCCGCCCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl