Prev. |  KEGG KO K07194 > 

RIKEN DNA Bank Human Resource - RHOQ

Gene ID NCBI Gene 23433 |  KEGG hsa:23433
Gene Symbol RHOQ
Protein Name ras homolog family member Q
Synonyms ARHQ|HEL-S-42|RASL7A|TC10|TC10A
Ortholog resource in our bank

  RHOQ

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX047745 IRAK119G01 pCMV-SPORT6 BC056154 NM_012249 Full
HGX056136 IRAK140F16 pCMV-SPORT6 BC065291 NM_012249 Full
HGX069715 IRAK174E19 pCMV-SPORT6 BC070485 NM_012249 Full
HGY097507 IRAL043M19 pOTB7 BC033251 NM_012249 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR055235 ARe38B11 pKA1U5 NM_012249.3  
GGCCGCCCTCCCCAAAGTTGCCGTCTCCCCCGGGGCCGGCCGGTCTTATGATCCGGCGGA
HKR168457 ARi21C09 pGCAP10 NM_012249.3  
GCTTATGATCCGNGCGGATCCTCCTGGGGAGGCCGGGCCGGGGNGTGGGTGCGGGCGCCG
HKR170083 ARi25D11 pGCAP10 NM_012249.3  
GGGGGCGGGGATCCGGGCGGCGACCGCGGCGGCGGCAGCGNCNNTNNNNNCGCCGCCCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl