Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05123

HP ID(1) HP05123
Gene ID(2) 23596
Gene Symbol finder OPN3
Protein Name opsin 3 (encephalopsin, panopsin)
RefSeq NM_014322.2
Length of RefSeq (bp) 2632
Chromosome 1q43
Reference DDBJ accession
UniGene Hs.534399

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe36C02 pKA1U5 GAGTGCACAATGGCTAGAGCAGGCGGCGGAGCCCCAACCCCACCCAGTGCGGAGCGCGCC
RBd25H01 pGCAP10 GAGTGCACAATGGCCAGAGCAGGCGGCGGAGCCCCAGCCCCACCCAGTGCGGAGCGCGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl