Prev. |  Human A to Z list >  O >  OPN3 > 

RBd25H01 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR370169
Clone Name RBd25H01
Clone info. Plasmid clone of human OPN3 cDNA with SV40 promoter
Vector plasmidClick for information pGCAP10
5'-terminal sequence(1) GAGTGCACAATGGCCAGAGCAGGCGGCGGAGCCCCAGCCCCACCCAGTGCGGAGCGCGCC
Sequence, submitted(2) n.a.
 
Sequence, refered NM_014322.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) OPN3 (NCBI Gene 23596) finder other clone of OPN3 in our bank
Synonyms ECPN
Protein Name opsin 3
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR370169 RBd25H01 DNA solution

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2017.10.31

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_171016.pl