Prev. |  KEGG KO K04256 > 

RIKEN DNA Bank Human Resource - OPN3

Gene ID NCBI Gene 23596 |  KEGG hsa:23596
Gene Symbol OPN3
Protein Name opsin 3
Synonyms ECPN|PPP1R116
Ortholog resource in our bank

  OPN3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX066476 IRAK166D04 pCMV-SPORT6 BC073872 NM_001030011 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR054450 ARe36C02 pKA1U5 NM_014322.2  
GAGTGCACAATGGCTAGAGCAGGCGGCGGAGCCCCAACCCCACCCAGTGCGGAGCGCGCC
HKR370169 RBd25H01 pGCAP10 NM_014322.2  
GAGTGCACAATGGCCAGAGCAGGCGGCGGAGCCCCAGCCCCACCCAGTGCGGAGCGCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl