Prev. | NRCD Clone M | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05121

HP ID(1) HP05121
Gene ID(2) 4150
Gene Symbol finder MAZ
Protein Name MYC-associated zinc finger protein (purine-binding transcription factor)
RefSeq NM_002383.2
Length of RefSeq (bp) 2564
Chromosome 16p11.2
Reference DDBJ accession
UniGene Hs.23650

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe36B07 pKA1U5 GGCCCTCCTTTCCTCCCTCCCGCCGGNCGGGGNGCTCGGGCAGCGGGGCGGCNCGCAATG
ARi30C08 pGCAP10 GCTTTGCCTCCCAGGGCTGCGCCCAGAGTCCATTCCAGGCCGCGCCGGCGCCCCCGCCCA
RBb57A02 pGCAP1 TGCCTCCCTCCCGCCGGCCGGGGATGCGCGGGCGGCAAGGGCNGCCNGCACGGCCATGCG
RBd28C02 pGCAP10 GAGTCCCGCTTCTTTGCCTCCCAGGGCTGCGCCCAGAGTCCATTCCAGGCCGCGCCGGCG
RBdS015I16 pGCAP10 GAATTGGCCCTCCTTTCCTCCCTCCCGCCGGCCGGGGTGCGCGGGCGGCNGGGCGGCCCG
RBdS110G21 pGCAP10 GGCCGCGGCGCTCCGCGGCCCGCAAGGCGCCCCCGGCCCCCGCTGAGCCCTGGGGGCCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl