Prev. | 

RIKEN DNA Bank Human Resource - MAZ

Gene ID NCBI Gene 4150 |  KEGG hsa:4150
Gene Symbol MAZ
Protein Name MYC associated zinc finger protein
Synonyms PUR1|Pur-1|SAF-1|SAF-2|SAF-3|ZF87|ZNF801|Zif87
Links

  KEGG gene

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB02486 pAxCAhSMAZ (forward) Shuttle vector to produce rAd expressing human MAZ
RDB02487 pAxCAhSMAZ (reverse) Shuttle vector to produce rAd expressing human MAZ
RDB02597 pAxCAhMAZHis (forward) Shuttle vector to produce rAd expressing human MAZ
RDB02598 pAxCAhMAZHis (reverse) Shuttle vector to generate rAd harboring human MAZ cDNA
RDB02599 pAxCACBPhMAZHis (forward) Shuttle vector to produce rAd expressing human MAZ
RDB02600 pAxCACBPhMAZHis (reverse) Shuttle vector to generate rAd harboring human MAZ cDNA
RDB02681 pAxCALNLhSMAZ (forward) Shuttle vector to produce rAd expressing human MAZ
RDB02682 pAxCALNLhSMAZ (reverse) Shuttle vector to produce rAd expressing human MAZ
RDB02702 pAxCALNLhMAZHis (forward) Shuttle vector to produce rAd expressing human MAZ
RDB02703 pAxCALNLhMAZHis (reverse) Shuttle vector to produce rAd expressing human MAZ
RDB02830 pAxCALNLCBPhMAZHis (forward) Shuttle vector to generate rAd expressing human MAZ
RDB02831 pAxCALNLCBPhMAZHis (reverse) Shuttle vector to generate rAd harboring MAZ
RDB03219 pCMV-MAZ Human MAZ cDNA is cloned into EcoRI site of pcDNA3
RDB03323 pB42AD-MAZ (forward) Plasmid clone of human MAZ for yeast two-hybrid system
RDB03324 pB42AD-MAZ (reverse) Plasmid clone of human MAZ for yeast two-hybrid system
RDB03325 pB42AD-MAZ4 (forward) Plasmid clone of human MAZ for yeast two-hybrid system
RDB03326 pB42AD-ZFNo.1 (forward) Plasmid clone of human MAZ for yeast two-hybrid system
RDB03327 pB42AD-ZFNo.1 (reverse) Plasmid clone of human MAZ for yeast two-hybrid system
RDB03328 pB42AD-MAZ9 (forward) Plasmid clone of human MAZ for yeast two-hybrid system
RDB03329 pB42AD-MAZ10(forward) Plasmid clone of human MAZ for yeast two-hybrid system
RDB03330 pB42AD-MAZ12(forward) Plasmid clone of human MAZ for yeast two-hybrid system
RDB03331 pB42AD-MAZ13 (forward) Plasmid clone of human MAZ for yeast two-hybrid system
RDB04272 pCMV-MAZ delta 1-53 Expression vector of human MAZ
RDB04273 pCMV-MAZ delta 54-195 Expression vector of human MAZ
RDB04274 pCMV-MAZ delta 127-292 Expression vector of human MAZ
RDB05701 pGEX-hMAZ Expression vector of human MAZ in E. coli
RDB04788 pCMV-MAZ Human MAZ cDNA is cloned into EcoRI site of pcDNA3
RDB05971 pGEX-MAZ-X Human MAZ cDNA
RDB05972 pGEX-MAZ-delta3 Human MAZ cDNA
RDB05973 pGEX-MAZ-delta4 Human MAZ cDNA
RDB05974 pGEX-MAZ-delta34 Human MAZ cDNA

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX016908 IRAK042E12 pCMV-SPORT6 BC039057 NM_002383 Partial/var
HGY097689 IRAL044D17 pOTB7 BC041629 NM_002383 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR054431 ARe36B07 pKA1U5 NM_002383.2  
GGCCCTCCTTTCCTCCCTCCCGCCGGNCGGGGNGCTCGGGCAGCGGGGCGGCNCGCAATG
HKR172056 ARi30C08 pGCAP10 NM_002383.2  
GCTTTGCCTCCCAGGGCTGCGCCCAGAGTCCATTCCAGGCCGCGCCGGCGCCCCCGCCCA
HKR342802 RBb57A02 pGCAP1 NM_002383.2  
TGCCTCCCTCCCGCCGGCCGGGGATGCGCGGGCGGCAAGGGCNGCCNGCACGGCCATGCG
HKR371250 RBd28C02 pGCAP10 NM_002383.2  
GAGTCCCGCTTCTTTGCCTCCCAGGGCTGCGCCCAGAGTCCATTCCAGGCCGCGCCGGCG
HKR406208 RBdS015I16 pGCAP10 NM_002383.2  
GAATTGGCCCTCCTTTCCTCCCTCCCGCCGGCCGGGGTGCGCGGGCGGCNGGGCGGCCCG
HKR444165 RBdS110G21 pGCAP10 NM_002383.2  
GGCCGCGGCGCTCCGCGGCCCGCAAGGCGCCCCCGGCCCCCGCTGAGCCCTGGGGGCCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl