Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015I16

Clone ID RBdS015I16
HP ID HP05121
Gene ID 4150
Gene Symbol MAZ
Protein Name MYC-associated zinc finger protein (purine-binding transcription factor)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002383.2
Length of RefSeq (bp) 2564
Chromosome 16p11.2
Reference DDBJ accession
UniGene Hs.23650
5'-terminal sequence GAATTGGCCCTCCTTTCCTCCCTCCCGCCGGCCGGGGTGCGCGGGCGGCNGGGCGGCCCG
2011.08.28