Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05055

HP ID(1) HP05055
Gene ID(2) 91582
Gene Symbol finder RPS19BP1
Protein Name ribosomal protein S19 binding protein 1
RefSeq NM_194326.2
Length of RefSeq (bp) 952
Chromosome 22q13.1
Reference DDBJ accession
UniGene Hs.526933

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe31F02 pKA1U5 GGCGCCGCCATGTCCGCCGCCCTGCTGCGGCGGGGCCTGGAGCTGCTGGCGGCGTCCGAG
RBd03H09 pGCAP10 GGGGCGGAGCCAAGCGCCGCCATGTCCGCCGCCCTGCTGCGGCGGGGCCTGGAGCTGCTG
RBd87E10 pGCAP10 TGAAGCGCCGCCATGTCCGCCGCCCTGCTGCGGCGGGGCCTGGAGCTGCTGGCGGCGTCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl